SGN Marker solcap_snp_sl_6016

SGN-M25065

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69580)
Chromosome
11
Position
58.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61396)
Chromosome
11
Position
49.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATTCTTTTTGGATCAGAAAATAATTGAAATTCGCGATAAAGAAAAATT
  
3' flanking region
TTGTTTTGATCTTCCATTGAAGGGTTCATTGATTTCTGAGCTTTTTGGTT
SNP nucleotide
CG
SNPdb format
ATATTCTTTTTGGATCAGAAAATAATTGAAATTCGCGATAAAGAAAAATT[C/G]
TTGTTTTGATCTTCCATTGAAGGGTTCATTGATTTCTGAGCTTTTTGGTT
  
Genomic location of solcap_snp_sl_6016  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25065 marker 25065
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)