SGN Marker solcap_snp_sl_6051

SGN-M25099

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73921)
Chromosome
11
Position
55.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69597)
Chromosome
11
Position
57.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65932)
Chromosome
11
Position
66.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61430)
Chromosome
11
Position
48.57 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGATACGGGTACAGCAACATATTTTGAGAGTCTGCACAATATAGGACT
  
3' flanking region
CTCTGTTTCCTATACTCTCATACCAGATCAATCTGCCCACTCTCCACAAG
SNP nucleotide
TG
SNPdb format
TTTGATACGGGTACAGCAACATATTTTGAGAGTCTGCACAATATAGGACT[T/G]
CTCTGTTTCCTATACTCTCATACCAGATCAATCTGCCCACTCTCCACAAG
  
Genomic location of solcap_snp_sl_6051  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25099 marker 25099
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)