SGN Marker solcap_snp_sl_60831

SGN-M25131

Synonyms  
SGN-U580929_snp1286
SGN-U580929_snp1286_solcap_snp_sl_60831
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70460)
Chromosome
10
Position
73.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66990)
Chromosome
10
Position
80.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63466)
Chromosome
10
Position
109.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61462)
Chromosome
10
Position
63.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCATGGTAAATTACTGCAAGAGTTTCGAAGAAACAGATTTCAAAAATAT
  
3' flanking region
TTGTTTAGGAGTCAAAAAGCTACATCTGTAATAGAGAATGAACCCACAAG
SNP nucleotide
AT
SNPdb format
TGCATGGTAAATTACTGCAAGAGTTTCGAAGAAACAGATTTCAAAAATAT[A/T]
TTGTTTAGGAGTCAAAAAGCTACATCTGTAATAGAGAATGAACCCACAAG
  
Genomic location of solcap_snp_sl_60831  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25131 marker 25131
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)