SGN Marker solcap_snp_sl_60886

SGN-M25139

Synonyms  
SGN-U569186_snp518
SGN-U569186_snp518_solcap_snp_sl_60886
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70397)
Chromosome
10
Position
71.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66929)
Chromosome
10
Position
75.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63411)
Chromosome
10
Position
106.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61470)
Chromosome
10
Position
63.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCCCAATTATGTTACACCCATCTCTCTCCAACAATTTCTTCAAATTCTC
  
3' flanking region
ACTTTCTCTATCACAATTTTCTCACTTGCAGTCCCACCAAACTTCATCAC
SNP nucleotide
TC
SNPdb format
TCCCCAATTATGTTACACCCATCTCTCTCCAACAATTTCTTCAAATTCTC[T/C]
ACTTTCTCTATCACAATTTTCTCACTTGCAGTCCCACCAAACTTCATCAC
  
Genomic location of solcap_snp_sl_60886  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25139 marker 25139
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)