SGN Marker solcap_snp_sl_6106

SGN-M25155

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73959)
Chromosome
11
Position
52.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69619)
Chromosome
11
Position
53.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65952)
Chromosome
11
Position
64.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61486)
Chromosome
11
Position
47.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTCACTTCTTGCAACATTTTTTCCTCATGTTTCTGCAACTTCTCCACA
  
3' flanking region
CCTCTTCGCTCTCTTTAAGCACAGATCGAATAGCATCTAATTCTGCAATT
SNP nucleotide
AG
SNPdb format
TTGTCACTTCTTGCAACATTTTTTCCTCATGTTTCTGCAACTTCTCCACA[A/G]
CCTCTTCGCTCTCTTTAAGCACAGATCGAATAGCATCTAATTCTGCAATT
  
Genomic location of solcap_snp_sl_6106  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25155 marker 25155
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)