SGN Marker solcap_snp_sl_61089

SGN-M25159

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73961)
Chromosome
10
Position
64.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69620)
Chromosome
10
Position
67.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65953)
Chromosome
10
Position
100.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61490)
Chromosome
10
Position
62.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCCCATAATTCTTCAAAACATGCTTAGCAATAGCAGGATCACTAACAAT
  
3' flanking region
ACAAAATTCCTCGGCCCAGCAGCAAGACGATAAATAGGTCCATACAAATT
SNP nucleotide
AG
SNPdb format
TTCCCATAATTCTTCAAAACATGCTTAGCAATAGCAGGATCACTAACAAT[A/G]
ACAAAATTCCTCGGCCCAGCAGCAAGACGATAAATAGGTCCATACAAATT
  
Genomic location of solcap_snp_sl_61089  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25159 marker 25159
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)