SGN Marker solcap_snp_sl_61127

SGN-M25166

Synonyms  
SGN-U598818_snp288
SGN-U598818_snp288_solcap_snp_sl_61127
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70491)
Chromosome
10
Position
64.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61497)
Chromosome
10
Position
62.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGAGTTGTTCATTCTTTTTGGTTCTAGCATAAAGTATTCGAGTTGATGA
  
3' flanking region
TCGAATCTGTTTTGTTCTCTGTGTATATTCCAATGAATATGTTTGAAGGT
SNP nucleotide
TC
SNPdb format
TCGAGTTGTTCATTCTTTTTGGTTCTAGCATAAAGTATTCGAGTTGATGA[T/C]
TCGAATCTGTTTTGTTCTCTGTGTATATTCCAATGAATATGTTTGAAGGT
  
Genomic location of solcap_snp_sl_61127  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25166 marker 25166
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)