SGN Marker solcap_snp_sl_61175

SGN-M25170

Synonyms  
SGN-U563149_snp1239
SGN-U563149_snp1239_solcap_snp_sl_61175
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70371)
Chromosome
10
Position
62.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61501)
Chromosome
10
Position
62.57 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTCCTTAATACTTTCCCTTTTCCTTCATTGAAAAAAGTACTCAATGCAC
  
3' flanking region
AATTGTTCCACTTTTAGTAAAATTCCCACCTTCAATTTGCAAACCAATTT
SNP nucleotide
TC
SNPdb format
TTTCCTTAATACTTTCCCTTTTCCTTCATTGAAAAAAGTACTCAATGCAC[T/C]
AATTGTTCCACTTTTAGTAAAATTCCCACCTTCAATTTGCAAACCAATTT
  
Genomic location of solcap_snp_sl_61175  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25170 marker 25170
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)