SGN Marker solcap_snp_sl_61460

SGN-M25195

Synonyms  
CL017699-0108
CL017699-0108_solcap_snp_sl_61460
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61526)
Chromosome
3
Position
63.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGACACAAAACTACCCAGAAAAATTCTTCGAATATTTTATGGAATTGTTC
  
3' flanking region
TAAATTCAAAAATCCCATGAACTGTGTGTTTTGTATGAATTGCATGGGAT
SNP nucleotide
AG
SNPdb format
TGACACAAAACTACCCAGAAAAATTCTTCGAATATTTTATGGAATTGTTC[A/G]
TAAATTCAAAAATCCCATGAACTGTGTGTTTTGTATGAATTGCATGGGAT
  
Genomic location of solcap_snp_sl_61460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25195 marker 25195
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)