SGN Marker solcap_snp_sl_61632

SGN-M25209

Synonyms  
SGN-U577717_snp348
SGN-U577717_snp348_solcap_snp_sl_61632
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70439)
Chromosome
3
Position
95.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66964)
Chromosome
3
Position
90.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61540)
Chromosome
3
Position
61.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTAATATTTTTATAAGCAAATTCCACACCTATAGTTGGCTTAGAATCAA
  
3' flanking region
CTGAAATTGATCTCTAGCAAATCTTGATAAAAGATTTGATTTTCCCACAG
SNP nucleotide
AG
SNPdb format
TCTAATATTTTTATAAGCAAATTCCACACCTATAGTTGGCTTAGAATCAA[A/G]
CTGAAATTGATCTCTAGCAAATCTTGATAAAAGATTTGATTTTCCCACAG
  
Genomic location of solcap_snp_sl_61632  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25209 marker 25209
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)