SGN Marker solcap_snp_sl_61634

SGN-M25210

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73993)
Chromosome
3
Position
95.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69642)
Chromosome
3
Position
89.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65974)
Chromosome
3
Position
99.93 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61541)
Chromosome
3
Position
61.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATCCTCAACTAAAAGTTTGAAATACCAACATCAACACGTTTTTACAGTG
  
3' flanking region
AAGTACTATTTTAAAAATATGTTATATCCCAGAAAGGAAAAACATTCAAA
SNP nucleotide
TC
SNPdb format
AATCCTCAACTAAAAGTTTGAAATACCAACATCAACACGTTTTTACAGTG[T/C]
AAGTACTATTTTAAAAATATGTTATATCCCAGAAAGGAAAAACATTCAAA
  
Genomic location of solcap_snp_sl_61634  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25210 marker 25210
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)