SGN Marker solcap_snp_sl_61928

SGN-M25245

Synonyms  
CL017760-0371
CL017760-0371_solcap_snp_sl_61928
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61576)
Chromosome
3
Position
59.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATCCAACTGTTTTCCAGTTTTCGTTAACAGAATCGTACACTTCTAAGCT
  
3' flanking region
GGCTCGTATGAAGCACCTCCTCCGGTGCTGCTTGCCACTGACATTCCTCC
SNP nucleotide
TG
SNPdb format
GATCCAACTGTTTTCCAGTTTTCGTTAACAGAATCGTACACTTCTAAGCT[T/G]
GGCTCGTATGAAGCACCTCCTCCGGTGCTGCTTGCCACTGACATTCCTCC
  
Genomic location of solcap_snp_sl_61928  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25245 marker 25245
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)