SGN Marker solcap_snp_sl_62065

SGN-M25260

Synonyms  
CL016145-0246
CL016145-0246_solcap_snp_sl_62065
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61591)
Chromosome
3
Position
59.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CACTACCCTCAGATGAAAAGTATCTGGGGTTCATCTTTAAAGGGTTTTGG
  
3' flanking region
AATTCGTCAACGCTAATCCACGAACTTGAAATCTGAGATTCTCCGTATAC
SNP nucleotide
TC
SNPdb format
CACTACCCTCAGATGAAAAGTATCTGGGGTTCATCTTTAAAGGGTTTTGG[T/C]
AATTCGTCAACGCTAATCCACGAACTTGAAATCTGAGATTCTCCGTATAC
  
Genomic location of solcap_snp_sl_62065  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25260 marker 25260
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)