SGN Marker solcap_snp_sl_62120

SGN-M25261

Synonyms  
CL017463-0220
CL017463-0220_solcap_snp_sl_62120
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61592)
Chromosome
3
Position
58.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGGGATGACAGCCCCTGGCAAACTGAACTATCATTTTTTGCACTATTTA
  
3' flanking region
CTCGACGCCAGTATCAACTTCATTCACATGAGATCCTACATCTCCTCCTC
SNP nucleotide
TC
SNPdb format
CTGGGATGACAGCCCCTGGCAAACTGAACTATCATTTTTTGCACTATTTA[T/C]
CTCGACGCCAGTATCAACTTCATTCACATGAGATCCTACATCTCCTCCTC
  
Genomic location of solcap_snp_sl_62120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25261 marker 25261
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)