SGN Marker solcap_snp_sl_62348

SGN-M25284

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74027)
Chromosome
3
Position
76.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69669)
Chromosome
3
Position
65.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65999)
Chromosome
3
Position
70.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61615)
Chromosome
3
Position
57.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTGAAGGGACAAAATGTGGACTACATTTTTTTTTCTACTGATATTGCG
  
3' flanking region
TCTTCTGTTTATTTCATCTTTATGAGCAAAGTGTCAATCTTGGATTCATC
SNP nucleotide
TG
SNPdb format
GTTTGAAGGGACAAAATGTGGACTACATTTTTTTTTCTACTGATATTGCG[T/G]
TCTTCTGTTTATTTCATCTTTATGAGCAAAGTGTCAATCTTGGATTCATC
  
Genomic location of solcap_snp_sl_62348  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25284 marker 25284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)