SGN Marker solcap_snp_sl_62362

SGN-M25286

Synonyms  
CL017298-0054
CL017298-0054_solcap_snp_sl_62362
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61617)
Chromosome
3
Position
57.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTATGCTGCTTCGACAAATTTGGCAAACCCGACGGACGGAATGTATCATC
  
3' flanking region
GGCCTCCATGCCCGGCAACTGAGAGGAGGTCTAGGTGTCAATCCTCTGGC
SNP nucleotide
TG
SNPdb format
CTATGCTGCTTCGACAAATTTGGCAAACCCGACGGACGGAATGTATCATC[T/G]
GGCCTCCATGCCCGGCAACTGAGAGGAGGTCTAGGTGTCAATCCTCTGGC
  
Genomic location of solcap_snp_sl_62362  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25286 marker 25286
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)