SGN Marker solcap_snp_sl_62467

SGN-M25295

Synonyms  
SGN-U565563_snp1042
SGN-U565563_snp1042_solcap_snp_sl_62467
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70383)
Chromosome
3
Position
73.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66914)
Chromosome
3
Position
61.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63396)
Chromosome
3
Position
68.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61626)
Chromosome
3
Position
57.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTAATCATCCCAATTTTCCTTCCCAAATTGTGAATCCAGGGGAAACTTA
  
3' flanking region
AAGCACATTATGGTTTATAGGTTCACTGCCTCATAAAAACTTTAAGATTT
SNP nucleotide
TC
SNPdb format
GTTAATCATCCCAATTTTCCTTCCCAAATTGTGAATCCAGGGGAAACTTA[T/C]
AAGCACATTATGGTTTATAGGTTCACTGCCTCATAAAAACTTTAAGATTT
  
Genomic location of solcap_snp_sl_62467  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25295 marker 25295
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)