SGN Marker solcap_snp_sl_62864

SGN-M25342

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69686)
Chromosome
11
Position
44.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66015)
Chromosome
11
Position
45.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61673)
Chromosome
11
Position
6.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTACAATTTTCACCCAGATGAGCATGCTAGCCATCAAGCATGGAGCTAT
  
3' flanking region
AACCTCGGCCAGGGCTTCCCCAACTTTGACGGCCCGGATTTTGTTAAAGA
SNP nucleotide
AC
SNPdb format
ACTACAATTTTCACCCAGATGAGCATGCTAGCCATCAAGCATGGAGCTAT[A/C]
AACCTCGGCCAGGGCTTCCCCAACTTTGACGGCCCGGATTTTGTTAAAGA
  
Genomic location of solcap_snp_sl_62864  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25342 marker 25342
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)