SGN Marker solcap_snp_sl_62925

SGN-M25350

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74053)
Chromosome
10
Position
27.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61681)
Chromosome
10
Position
4.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATCCACCCCCACCCCCACCCCAGCAACCCTATGGATACCCACCACCAC
  
3' flanking region
ACAACAACCCCCTATATACCCTCCACCCAATTATGCACCAAGTGGTGTTG
SNP nucleotide
AC
SNPdb format
ATATCCACCCCCACCCCCACCCCAGCAACCCTATGGATACCCACCACCAC[A/C]
ACAACAACCCCCTATATACCCTCCACCCAATTATGCACCAAGTGGTGTTG
  
Genomic location of solcap_snp_sl_62925  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25350 marker 25350
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)