SGN Marker solcap_snp_sl_62952

SGN-M25354

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69695)
Chromosome
10
Position
34.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66024)
Chromosome
10
Position
41.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61685)
Chromosome
10
Position
3.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTGAATTTGTGTAAAAAGAATGAATCTGTCTCTCTGTCCTCTACCTTCC
  
3' flanking region
TCAACATAAGTGTAGAATAGCAATTAAACAAAGCCTCTAGAGGAAAGGCA
SNP nucleotide
AC
SNPdb format
CTTGAATTTGTGTAAAAAGAATGAATCTGTCTCTCTGTCCTCTACCTTCC[A/C]
TCAACATAAGTGTAGAATAGCAATTAAACAAAGCCTCTAGAGGAAAGGCA
  
Genomic location of solcap_snp_sl_62952  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25354 marker 25354
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)