SGN Marker solcap_snp_sl_63109

SGN-M25367

Synonyms  
CL017202-0450
CL017202-0450_solcap_snp_sl_63109
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61698)
Chromosome
3
Position
0.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCCATATGATGATGCCCACTATTGAGTCGAGGGTCGGTCTGCATAATCA
  
3' flanking region
ATCACTTGCACTATCAAAAAGGCCTCCAGAATAGTTATGCTGGAACACGT
SNP nucleotide
TC
SNPdb format
GTCCATATGATGATGCCCACTATTGAGTCGAGGGTCGGTCTGCATAATCA[T/C]
ATCACTTGCACTATCAAAAAGGCCTCCAGAATAGTTATGCTGGAACACGT
  
Genomic location of solcap_snp_sl_63109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25367 marker 25367
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)