SGN Marker solcap_snp_sl_63301

SGN-M25381

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69706)
Chromosome
3
Position
21.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66036)
Chromosome
3
Position
25.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61712)
Chromosome
3
Position
1.53 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGTCCCAAGAAATCTCAAAGTGGCAGTAGCGCTTCTACCTGCCGCGTAG
  
3' flanking region
GCTTGATTGCTCTTCCTTCTCTTTCACCAACTGCTACTGCCGGAAGAAGG
SNP nucleotide
AC
SNPdb format
TAGTCCCAAGAAATCTCAAAGTGGCAGTAGCGCTTCTACCTGCCGCGTAG[A/C]
GCTTGATTGCTCTTCCTTCTCTTTCACCAACTGCTACTGCCGGAAGAAGG
  
Genomic location of solcap_snp_sl_63301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25381 marker 25381
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)