SGN Marker solcap_snp_sl_63761

SGN-M25417

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69717)
Chromosome
4
Position
8.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66046)
Chromosome
4
Position
4.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61748)
Chromosome
4
Position
0.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCCTCTACTTGAAATCAACTTCTTCTTTGAACTTCCCATTCTGTTGTTG
  
3' flanking region
TGGTGGTGGTGGTGCTCATCTTCATCATGTAACTTTAATTCGTCGCGACG
SNP nucleotide
TG
SNPdb format
GTCCTCTACTTGAAATCAACTTCTTCTTTGAACTTCCCATTCTGTTGTTG[T/G]
TGGTGGTGGTGGTGCTCATCTTCATCATGTAACTTTAATTCGTCGCGACG
  
Genomic location of solcap_snp_sl_63761  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25417 marker 25417
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)