SGN Marker solcap_snp_sl_63976

SGN-M25433

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74091)
Chromosome
4
Position
11.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69722)
Chromosome
4
Position
19.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66051)
Chromosome
4
Position
16.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61764)
Chromosome
4
Position
1.56 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACAAATCTCTTTGATAATTTAACTTGGAAGCCAGTGGCTATATGGCGCC
  
3' flanking region
GAGTACGTTATGTATGGACATCTATCAGTGAAGGCTGATGTATTCAGTTT
SNP nucleotide
AC
SNPdb format
AACAAATCTCTTTGATAATTTAACTTGGAAGCCAGTGGCTATATGGCGCC[A/C]
GAGTACGTTATGTATGGACATCTATCAGTGAAGGCTGATGTATTCAGTTT
  
Genomic location of solcap_snp_sl_63976  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25433 marker 25433
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)