SGN Marker solcap_snp_sl_63996

SGN-M25434

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74092)
Chromosome
4
Position
12.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69723)
Chromosome
4
Position
21.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61765)
Chromosome
4
Position
1.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCTTCTTCTTCCTCCATTCTTCATTTATCAATAATCGAAACCCTAATT
  
3' flanking region
CACCTTCCGTTACACTGTATAGCTCAGCTCAGCTCTGGATCTGACTCACT
SNP nucleotide
TC
SNPdb format
CTTCTTCTTCTTCCTCCATTCTTCATTTATCAATAATCGAAACCCTAATT[T/C]
CACCTTCCGTTACACTGTATAGCTCAGCTCAGCTCTGGATCTGACTCACT
  
Genomic location of solcap_snp_sl_63996  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25434 marker 25434
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)