Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_64082

SGN-M25439

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74095)
Chromosome
4
Position
15.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61770)
Chromosome
4
Position
2.14 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAAAGTAACAACATAAATGAATATGGTAGAAAGATTCAGAATAGGCGAC
  
3' flanking region
GATAATATTTTTAGGAATGAAACAATCCATTTTCCACTGTAAACAACTAT
SNP nucleotide
AG
SNPdb format
TGAAAGTAACAACATAAATGAATATGGTAGAAAGATTCAGAATAGGCGAC[A/G]
GATAATATTTTTAGGAATGAAACAATCCATTTTCCACTGTAAACAACTAT
  
Genomic location of solcap_snp_sl_64082  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25439 marker 25439
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)