SGN Marker TG437

SGN-M255

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG437 image not available
Forward sequence
CTTGTTAGTTGCTGTTGTTACTTAATCATCAGCATTTCCAATAAATGATGTATTGCTTGGTAATACTGTACTGTGAAACTGTAAAATTTA
AGAGAGAAATGGAGTGAATACAGTGAAAATGCAGAGACTCTACATTCAGACAAAGTGGTCTTTAAAACATGGCGCAAAATGAAATAAGCT
GAGAATTTCTAATTTTCTTCAATGAGATAATTATTGTTGGAACTTCTATCAATACGTTAATCTGTAGCTCTATCAAACTGGCAGTGCCTA
GGAACCCAGACTTTAGCCTGGACGTTGAACGGATTACCGAAGTGGTTGAACGTGAGAAACCAAAGTGCATATTTCTGACATCACCTAATA
ATCCTGATGGGAGGTATTGCTACATTGTATTCTTTGTCTATTTCTCATTGTGGTTGTACTTTGCTCCCCTTGATTGGACTGCATGTGAGA
GTTTCTCTACCCCCAATCCCACCTGTCTTAGTTCCAATCATCTTCAAAGCTTT
Reverse sequence
CTCCTATAGGGAGACAGCTTGCATGCCTGCAGCATGGAATCTACATCATTTATAATGGCCATGTTGCACCAAAAAATCTAGCAAAGAAAT
ACAATTTTGTTTAAGATTATGCATGTTGCAATGTTTGTCTTCAAAAAATCAGTATGTTTCTTTCCATCCATATTGTCCACCAAACGATTA
TGGGAATAGTATCGCGACCATCTCATCATTGGTGTTCTCCTCCAATTAAAAAAGAAACACAGTATTACTGGCTAAATTGAGATTCTAGTA
ATACTTTCCTATTAGTCATTTTCTCCATCTCACGAACCTAGAAAATAGTGAAAAAAATGAAAAAAGGAAAGCTGCAACTGAAAGCTTTGA
AGATGATTGGAACTAAGACAGGTGGGATTGGGGGTAGAGAAACTCTCACATGCAGTACAATCAAGGGGAGCAAAGTACAACCACAATGAG
AAATAGACAAAGAATACAATGTAGCAATACCTCCCATCAGGATTATTAGGTGATGTCAGAAATATGCACTTTGGTTTCTCACGTTCAACC
ACTTCGGTAATCCGTTCAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1476541.7e-56110 (21.9% of RFLP seq)+
SGN-U1476546e-3879 (14.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40043)
Chromosome
4
Position
18.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8738)
Chromosome
1
Position
126.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG437 was used as an overgo probe on plate 3 [well G3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CAGACTTTAGCCTGGACGTTGAAC
B sequence
ACCACTTCGGTAATCCGTTCAACG
AB sequence
CAGACTTTAGCCTGGACGTTGAACGGATTA
Marker sequence
CTTGTTAGTTGCTGTTGTTACTTAATCATCAGCATTTCCAATAAATGATG
TATTGCTTGGTAATACTGTACTGTGAAACTGTAAAATTTAAGAGAGAAAT
GGAGTGAATACAGTGAAAATGCAGAGACTCTACATTCAGACAAAGTGGTC
TTTAAAACATGGCGCAAAATGAAATAAGCTGAGAATTTCTAATTTTCTTC
AATGAGATAATTATTGTTGGAACTTCTATCAATACGTTAATCTGTAGCTC
TATCAAACTGGCAGTGCCTAGGAACCCAGACTTTAGCCTGGACGTTGAAC
GGATTACCGAAGTGGTTGAACGTGAGAAACCAAAGTGCATATTTCTGACA
TCACCTAATAATCCTGATGGGAGGTATTGCTACATTGTATTCTTTGTCTA
TTTCTCATTGTGGTTGTACTTTGCTCCCCTTGATTGGACTGCATGTGAGA
GTTTCTCTACCCCCAATCCCACCTGTCTTAGTTCCAATCATCTTCAAAGC
TTT
Genomic location of TG437  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D255 marker 255
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)