SGN Marker solcap_snp_sl_65873

SGN-M25527

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69760)
Chromosome
3
Position
49.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66088)
Chromosome
3
Position
53.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61858)
Chromosome
3
Position
54.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTAACAATTTCACCATCATCAGGAGGAGGAGAAGACAATTTCGTAACAC
  
3' flanking region
ATCAATTTCAATATCTTTCACATCAACACTACAGGGTTCCATTGCATCTT
SNP nucleotide
AG
SNPdb format
ACTAACAATTTCACCATCATCAGGAGGAGGAGAAGACAATTTCGTAACAC[A/G]
ATCAATTTCAATATCTTTCACATCAACACTACAGGGTTCCATTGCATCTT
  
Genomic location of solcap_snp_sl_65873  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25527 marker 25527
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)