SGN Marker solcap_snp_sl_66088

SGN-M25544

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74163)
Chromosome
11
Position
22.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69769)
Chromosome
11
Position
25.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66096)
Chromosome
11
Position
29.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61875)
Chromosome
11
Position
3.18 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAACACTAGGTCATTTCTTCCTCCCTTCTGCCTAAGCCTTGGCGACGGA
  
3' flanking region
TCACCAAGTACCTGTACTAGTGGAAGGTAACATGTACTCCATAGAATAGT
SNP nucleotide
TG
SNPdb format
AAAACACTAGGTCATTTCTTCCTCCCTTCTGCCTAAGCCTTGGCGACGGA[T/G]
TCACCAAGTACCTGTACTAGTGGAAGGTAACATGTACTCCATAGAATAGT
  
Genomic location of solcap_snp_sl_66088  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25544 marker 25544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)