SGN Marker solcap_snp_sl_66351

SGN-M25553

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74166)
Chromosome
11
Position
9.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61884)
Chromosome
11
Position
1.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAACTACATATAATTGTTTTGCCTGGTGTTCACAAGCTGGAATTCTATTT
  
3' flanking region
ATATTTCAGCTTATAATATAATGTTCTTCTGTAAACCTCAAACGAGTAAG
SNP nucleotide
AT
SNPdb format
TAACTACATATAATTGTTTTGCCTGGTGTTCACAAGCTGGAATTCTATTT[A/T]
ATATTTCAGCTTATAATATAATGTTCTTCTGTAAACCTCAAACGAGTAAG
  
Genomic location of solcap_snp_sl_66351  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25553 marker 25553
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)