SGN Marker solcap_snp_sl_66528

SGN-M25562

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69775)
Chromosome
11
Position
5.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66102)
Chromosome
11
Position
10.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61893)
Chromosome
11
Position
0.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGCCGGAGCAAGCTGCTGCTGCTAAAAGGCTGTCGTCGGCGTCAGCTCC
  
3' flanking region
CCTAAAAAGAGGGATCATGGTTTGAGCCATGTTGCTGGAGCAGACGGTGG
SNP nucleotide
TG
SNPdb format
ACGCCGGAGCAAGCTGCTGCTGCTAAAAGGCTGTCGTCGGCGTCAGCTCC[T/G]
CCTAAAAAGAGGGATCATGGTTTGAGCCATGTTGCTGGAGCAGACGGTGG
  
Genomic location of solcap_snp_sl_66528  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25562 marker 25562
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)