SGN Marker solcap_snp_sl_6881

SGN-M25708

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74254)
Chromosome
11
Position
49.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69838)
Chromosome
11
Position
50.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66165)
Chromosome
11
Position
47.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62039)
Chromosome
11
Position
8.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTTTCTTTGCTTGGGTTGATTTGAGAGAAAGAACCTCCAAAGCCTCAGC
  
3' flanking region
GCACTGGCACGAACACACACATCATTTTTCTGATGTAAGAGGCCTAGGAG
SNP nucleotide
AT
SNPdb format
GCTTTCTTTGCTTGGGTTGATTTGAGAGAAAGAACCTCCAAAGCCTCAGC[A/T]
GCACTGGCACGAACACACACATCATTTTTCTGATGTAAGAGGCCTAGGAG
  
Genomic location of solcap_snp_sl_6881  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25708 marker 25708
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)