Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_69253

SGN-M25765

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69865)
Chromosome
4
Position
68.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66189)
Chromosome
4
Position
99.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62096)
Chromosome
4
Position
57.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGTTCATTCATTTCACTTCCAAATGAACAATTACGACGAATCCCTTCAT
  
3' flanking region
GAATGATTGATCATATTCTCCCCCTGAGCTACGACCGCGTGCTTGAAGAT
SNP nucleotide
TC
SNPdb format
CTGTTCATTCATTTCACTTCCAAATGAACAATTACGACGAATCCCTTCAT[T/C]
GAATGATTGATCATATTCTCCCCCTGAGCTACGACCGCGTGCTTGAAGAT
  
Genomic location of solcap_snp_sl_69253  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25765 marker 25765
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)