SGN Marker solcap_snp_sl_69262

SGN-M25769

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69867)
Chromosome
4
Position
68.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66192)
Chromosome
4
Position
97.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62100)
Chromosome
4
Position
57.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAATATTATTTGTTCATTTTAAGATGAATAAAGAATTAAGTCTGCAAGAT
  
3' flanking region
TTTATGGTCAAACCACTACCCTTGGAACTCATTGAGATTAGATCTTATAT
SNP nucleotide
CG
SNPdb format
TAATATTATTTGTTCATTTTAAGATGAATAAAGAATTAAGTCTGCAAGAT[C/G]
TTTATGGTCAAACCACTACCCTTGGAACTCATTGAGATTAGATCTTATAT
  
Genomic location of solcap_snp_sl_69262  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25769 marker 25769
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)