SGN Marker solcap_snp_sl_701

SGN-M25848

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74336)
Chromosome
11
Position
50.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69890)
Chromosome
11
Position
51.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66216)
Chromosome
11
Position
61.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62179)
Chromosome
11
Position
11.63 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGGAATTTACAATCAAATGTTGCAGGACTTTTCCAGCTACCAATGCACT
  
3' flanking region
CACCATCTGCCTTGCTTGAGAAACACAGCAGCAAGCCTAATGCCAAAACA
SNP nucleotide
AG
SNPdb format
AAGGAATTTACAATCAAATGTTGCAGGACTTTTCCAGCTACCAATGCACT[A/G]
CACCATCTGCCTTGCTTGAGAAACACAGCAGCAAGCCTAATGCCAAAACA
  
Genomic location of solcap_snp_sl_701  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25848 marker 25848
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)