Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_7939

SGN-M26015

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74436)
Chromosome
3
Position
65.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62346)
Chromosome
3
Position
56.01 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGCAACTCTTATACTATGATGGGTGTTCAATTATTGAGATGTGTACCAA
  
3' flanking region
TGCTTGTAACTGCTCACTTTAAGATGAAAAGCTGCCTTCACTGGTTAGTG
SNP nucleotide
AG
SNPdb format
TCGCAACTCTTATACTATGATGGGTGTTCAATTATTGAGATGTGTACCAA[A/G]
TGCTTGTAACTGCTCACTTTAAGATGAAAAGCTGCCTTCACTGGTTAGTG
  
Genomic location of solcap_snp_sl_7939  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26015 marker 26015
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)