SGN Marker solcap_snp_sl_8223

SGN-M26031

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74444)
Chromosome
4
Position
48.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69963)
Chromosome
4
Position
58.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66284)
Chromosome
4
Position
72.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62362)
Chromosome
4
Position
54.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACTGCACATTGTTTGCATTCAGAAGGTTTTGGAATTCACTGTAGTCTAT
  
3' flanking region
CTATGAGAATTTTCAGGATCCCACTCTGTCCCCTTCAGCTTTCCCTGCAT
SNP nucleotide
TC
SNPdb format
AACTGCACATTGTTTGCATTCAGAAGGTTTTGGAATTCACTGTAGTCTAT[T/C]
CTATGAGAATTTTCAGGATCCCACTCTGTCCCCTTCAGCTTTCCCTGCAT
  
Genomic location of solcap_snp_sl_8223  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26031 marker 26031
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)