SGN Marker solcap_snp_sl_8510

SGN-M26054

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69977)
Chromosome
2
Position
36.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66297)
Chromosome
2
Position
48.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62385)
Chromosome
2
Position
34.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTTAGAAAATCAGGATAGTAAACATTCCCTGGCCAAACAACCCCTTGGT
  
3' flanking region
GGGCATATTATCGCGTTTTATGAAGACATCTGCTTCCATGCCTCTCCTAT
SNP nucleotide
AG
SNPdb format
ATTTAGAAAATCAGGATAGTAAACATTCCCTGGCCAAACAACCCCTTGGT[A/G]
GGGCATATTATCGCGTTTTATGAAGACATCTGCTTCCATGCCTCTCCTAT
  
Genomic location of solcap_snp_sl_8510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26054 marker 26054
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)