SGN Marker solcap_snp_sl_8653

SGN-M26069

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74469)
Chromosome
1
Position
20.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66298)
Chromosome
1
Position
26.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62400)
Chromosome
1
Position
2.46 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAAAAATGCACTCACTTCAAGTTCCAATGAGAGTAATGTTCTTAAACTA
  
3' flanking region
ATTCACTTGATGAAGTAAGAAAATCAAAGAAGAAAAAACTAAAACTAAAA
SNP nucleotide
AT
SNPdb format
CCAAAAATGCACTCACTTCAAGTTCCAATGAGAGTAATGTTCTTAAACTA[A/T]
ATTCACTTGATGAAGTAAGAAAATCAAAGAAGAAAAAACTAAAACTAAAA
  
Genomic location of solcap_snp_sl_8653  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26069 marker 26069
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)