SGN Marker solcap_snp_sl_8697

SGN-M26079

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66302)
Chromosome
1
Position
26.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62410)
Chromosome
1
Position
1.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGACGCGGAAAAGTGAAGATAGCCTCCAAGCATTTCAATGCCGTCTCC
  
3' flanking region
CTTTTGCTTGGAGTGAGATTACCCCCGAACATAAGAAGAGAATAATCGGA
SNP nucleotide
AT
SNPdb format
TTTGACGCGGAAAAGTGAAGATAGCCTCCAAGCATTTCAATGCCGTCTCC[A/T]
CTTTTGCTTGGAGTGAGATTACCCCCGAACATAAGAAGAGAATAATCGGA
  
Genomic location of solcap_snp_sl_8697  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26079 marker 26079
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)