SGN Marker solcap_snp_sl_9116

SGN-M26110

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74484)
Chromosome
3
Position
88.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70000)
Chromosome
3
Position
85.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66316)
Chromosome
3
Position
93.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62441)
Chromosome
3
Position
60.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTCCCAAAACTTGAATCTTGAACAGAAACCCCACCAATAGTCATTCCA
  
3' flanking region
TTAGGTTAAGGAAATAGAAGCTAAAAAGCTGTGGATTTGGAACCATTTTA
SNP nucleotide
CG
SNPdb format
TTTTCCCAAAACTTGAATCTTGAACAGAAACCCCACCAATAGTCATTCCA[C/G]
TTAGGTTAAGGAAATAGAAGCTAAAAAGCTGTGGATTTGGAACCATTTTA
  
Genomic location of solcap_snp_sl_9116  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26110 marker 26110
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)