SGN Marker solcap_snp_sl_9127

SGN-M26118

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74485)
Chromosome
3
Position
88.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70001)
Chromosome
3
Position
85.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66317)
Chromosome
3
Position
93.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62449)
Chromosome
3
Position
60.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCTCCACTCCATTGCTGACCTCTTTGCTGTTGAATCTAAGAATTGATCT
  
3' flanking region
TCCTCCATATTACTTCCCACTCCAAGGGTCAGGAAACTACCATCCATGTT
SNP nucleotide
AG
SNPdb format
TCCTCCACTCCATTGCTGACCTCTTTGCTGTTGAATCTAAGAATTGATCT[A/G]
TCCTCCATATTACTTCCCACTCCAAGGGTCAGGAAACTACCATCCATGTT
  
Genomic location of solcap_snp_sl_9127  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26118 marker 26118
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)