Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_9292

SGN-M26147

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74488)
Chromosome
3
Position
80.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62478)
Chromosome
3
Position
58.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAATGGCAAGGGAATTCAAAAATGCATTTGATATGAAGAATGCTAAGAA
  
3' flanking region
GTGAGGGATGAAAAGGACAAGGTGGATGAAGTGAATAATGCAAGAAAAGA
SNP nucleotide
AC
SNPdb format
GAAATGGCAAGGGAATTCAAAAATGCATTTGATATGAAGAATGCTAAGAA[A/C]
GTGAGGGATGAAAAGGACAAGGTGGATGAAGTGAATAATGCAAGAAAAGA
  
Genomic location of solcap_snp_sl_9292  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26147 marker 26147
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)