SGN Marker solcap_snp_sl_9461

SGN-M26178

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70015)
Chromosome
11
Position
35.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62509)
Chromosome
11
Position
4.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAATGATGCTGCAGTATAGCCTGCAATTCCTGATGTAAGAGCATAAATAA
  
3' flanking region
CACCAAAGCTGTGAAAAGAGCTCCTCGGTTGTAGGGGTAAAACACACCAA
SNP nucleotide
TC
SNPdb format
GAATGATGCTGCAGTATAGCCTGCAATTCCTGATGTAAGAGCATAAATAA[T/C]
CACCAAAGCTGTGAAAAGAGCTCCTCGGTTGTAGGGGTAAAACACACCAA
  
Genomic location of solcap_snp_sl_9461  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26178 marker 26178
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)