SGN Marker solcap_snp_sl_9487

SGN-M26189

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70019)
Chromosome
11
Position
36.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62520)
Chromosome
11
Position
4.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACAATTTTCGCGATTCAGCTGTCTCTTACACTCTGGATACTCAATAAAAC
  
3' flanking region
ATTGGTATTTCGTAAATCCCAGTCAACGACAAGGTTTTTACTGTGTGTTG
SNP nucleotide
AG
SNPdb format
ACAATTTTCGCGATTCAGCTGTCTCTTACACTCTGGATACTCAATAAAAC[A/G]
ATTGGTATTTCGTAAATCCCAGTCAACGACAAGGTTTTTACTGTGTGTTG
  
Genomic location of solcap_snp_sl_9487  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26189 marker 26189
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)