SGN Marker solcap_snp_sl_9562

SGN-M26233

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74523)
Chromosome
11
Position
40.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62564)
Chromosome
11
Position
5.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAAGTTGCAGAAACACACAAAAAAAAATGAATTCTTGTCTCTGCAAGTG
  
3' flanking region
AGAGAGCAAAATGGGAGATTTGGGGTTTGAAAGAGTAAAGGGGTTTTCTT
SNP nucleotide
TG
SNPdb format
AGAAGTTGCAGAAACACACAAAAAAAAATGAATTCTTGTCTCTGCAAGTG[T/G]
AGAGAGCAAAATGGGAGATTTGGGGTTTGAAAGAGTAAAGGGGTTTTCTT
  
Genomic location of solcap_snp_sl_9562  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26233 marker 26233
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)