SGN Marker solcap_snp_sl_9597

SGN-M26234

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74524)
Chromosome
10
Position
27.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70038)
Chromosome
10
Position
35.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62565)
Chromosome
10
Position
4.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCCACCATCCTATGCTGCAGCAGATGCAGATGGCCGGAAATAACCCTAA
  
3' flanking region
CTGCTACAGGACCGTCTAAGGGGCGCACAGGTTCCTTCACATCTCAGTAA
SNP nucleotide
TC
SNPdb format
GCCCACCATCCTATGCTGCAGCAGATGCAGATGGCCGGAAATAACCCTAA[T/C]
CTGCTACAGGACCGTCTAAGGGGCGCACAGGTTCCTTCACATCTCAGTAA
  
Genomic location of solcap_snp_sl_9597  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26234 marker 26234
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)