Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_9681

SGN-M26242

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74528)
Chromosome
3
Position
6.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70042)
Chromosome
3
Position
15.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66355)
Chromosome
3
Position
17.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62573)
Chromosome
3
Position
1.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGGTGTGCATGTTTCAATACTGACAAAAAAGGGCCTTCAATGGTGTTGA
  
3' flanking region
CGCGCTAGTGAGAAATGAATTTGGTGGTTCTCTGTGCCTTCTTTCCGCTA
SNP nucleotide
TC
SNPdb format
CGGGTGTGCATGTTTCAATACTGACAAAAAAGGGCCTTCAATGGTGTTGA[T/C]
CGCGCTAGTGAGAAATGAATTTGGTGGTTCTCTGTGCCTTCTTTCCGCTA
  
Genomic location of solcap_snp_sl_9681  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26242 marker 26242
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)