SGN Marker solcap_snp_sl_9703

SGN-M26247

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74530)
Chromosome
3
Position
22.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70043)
Chromosome
3
Position
35.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66357)
Chromosome
3
Position
35.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62578)
Chromosome
3
Position
2.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACAGCTCTACAACTATTGCTCCGTTCATTCCTTCCTAGCACTTTTGAGGC
  
3' flanking region
AAGCTAGGAGGCTTAAGCTTCTCAACTTGACTCTGCAGAGATCCATGGCT
SNP nucleotide
AT
SNPdb format
ACAGCTCTACAACTATTGCTCCGTTCATTCCTTCCTAGCACTTTTGAGGC[A/T]
AAGCTAGGAGGCTTAAGCTTCTCAACTTGACTCTGCAGAGATCCATGGCT
  
Genomic location of solcap_snp_sl_9703  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26247 marker 26247
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)