SGN Marker solcap_snp_sl_9707

SGN-M26248

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74531)
Chromosome
12
Position
38.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70044)
Chromosome
12
Position
49.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66358)
Chromosome
12
Position
54.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62579)
Chromosome
12
Position
5.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCGAAAAGGACATCAGTCGTTCTAGTTTCTGTGGCAATATTCTGCCTT
  
3' flanking region
AGAAAAAAGGCACAAAAAGCGAATACATCTGAGTTTACAGGGTTTGGGAA
SNP nucleotide
AC
SNPdb format
CTCCGAAAAGGACATCAGTCGTTCTAGTTTCTGTGGCAATATTCTGCCTT[A/C]
AGAAAAAAGGCACAAAAAGCGAATACATCTGAGTTTACAGGGTTTGGGAA
  
Genomic location of solcap_snp_sl_9707  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26248 marker 26248
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)